Validation of Genotyping Method for L444P Mice Ear-Clips

David C, Revi Shahar Golan

Published: 2022-09-16 DOI: 10.17504/protocols.io.261ge4dewv47/v1

Abstract

Aim : the genotyping is used to identify if mice are heterozygote (hetero) or Wild-Type (WT), and the aim of the work is to validate the digestion method, and PCR program, the PCR primers, and the interpretation of the results.

General notes : There are two sets of primers – Neo primers to distinguish between WT and hetero samples, and L444P primers to detect L444P protein. Negative and positive samples are used to verify the digestion and PCR, by gel electrophoresis. Sequencing is used to verify the interpretation of the gel electrophoresis.

Steps

Digestion

Prepare Digestion mix: 15µL (Roche, cat 10241100) per 1000µL (Viagen, cat 402-E).

Add 50µL to each ear clip sample.

Heat for 55°C, 5h 0m 0s.

Heat 99°C for 0h 10m 0s.

Cool to 10°C.

Samples can be stored in -20°C until use.

PCR

Prepare PCR master mix (MM) as below ( per sample ):

2.5µL (VWR-Peqlab, cat 01-1020)
0.25µL (VWR-Peqlab, cat 01-1020)
0.5µL (10pmol/ µl)
0.5µL (10pmol/ µl)
0.5µL (40mM; VWR, cat 5100850-0500)
19.25µL (Promega, cat P1193)
Note
Primers details: Neo1: 5’GATTGCACGCAGGTTCTCCG3’ Neo2: 5’CCAACGCTATGTCCTGATAG3’ L444P_F: 5’CCCCAGATGACTT GATGCTGG3’ (marked in bold , an extra T, that does not appear on the sequence) L444P_R: 5’CCAGGTCAGGATCTCTGATGG3’

For each sample, add 23.5µL and 1.5µL.

PCR program:

A	B	C
Temp	Time	Cycles
94°C	5 min
94°C	30 sec	35 cycles
55°C	1 min
72°C	1 min
4°C	forever

10.

PCR product can be kept in 4°C for the short term, or at -20°C.

Gel electrophoresis

11.

Run PCR products on a pre-cast 2% SYBR-safe E-GEL (ThermoFisher, cat G521802), for 0h 30m 0s, along with a 100bp DNA ladder (NEB, N3231), and a negative control (no DNA, only MM).

Citation

For Neo primers, expected results are band at ~500bp for hetero samples and no band for wt (band for positive control, no band for negative control). For L444P primers, expected results are a band for every sample (band for positive, no band for negative).

Citation

Results of validations: Below in a gel image of L444P samples (MEFs and ear clips) that were digested and amplified as described above. C2 and C14 are MEF samples. 1555572, 155303, 155573 are ear clips digestions, pos sample is a hetero samples that was verified by sequencing.

Top gel image shows samples run with NEO primersBottom gel image shows samples run with L444P primers

The gel show that C2 is hetero (band for both Neo and L444P), and that C14 is wt (no band for Neo, and a clear band for L444P). The sequencing results verify the identification of C2 and C14.

Citation

Sequence validations: In order to validate the interpretation of the gel, the PCR products were sent to sequencing:

Note

When genotyping L444P ear-clips, to identify hetero/wt, one can run PCR of the digested material with Neo primers beside L444P primers (including positive and negative control), and identify by the presence/lack of band whether it is hetero or wt. There is need to sequence the PCR product.

Routine check of ear clips:

12.

Run digested ear clips with NEO primers in the first instance. Then choose one of three options:

If the ratio wt:hetero is 1:3, there is no need for further tests. Wt animals to be terminated.
If there are more wt than the 1:3 ratio, this suggested poor DNA for the samples that were not amplified, so need to amplify with L444P primers the samples that did not work, and sequence them.
If there are much more hetero than the 1:3 ratio, need to sequence all the samples.

Validation of Genotyping Method for L444P Mice Ear-Clips

Abstract

Steps

Digestion

PCR

Gel electrophoresis

Routine check of ear clips:

推荐阅读