Prepare Samples for Miseq

Design primers surrounding your site of interest

• Optimal amplicon size 200bp
• As far as possible, the site of interest should be in the middle of the designed amplicon. (This is so that it has the best chance of being read by both the forward and reverse reads)
• If possible, try and avoid designing primers in non-coding regions of DNA since these regions are more likely to have variation and SNPs, which might affect the efficacy of your primer.

I usually use the NCBI Primer-Blast tool. Enter ~300bp of DNA sequence around your region of interest under 'PCR Template' and set the 'Range' for the forward and reverse primer so that your site of interest is more or less in the middle of the PCR product. NCBI Primer-Blast tool. Enter ~300bp of DNA sequence around your region of interest under 'PCR Template' and set the 'Range' for the forward and reverse primer so that your site of interest is more or less in the middle of the PCR product.

If you previously used a set of primers to check your TALLEN/CRISPR efficiency using Melt Curve Analysis, or if you have your primer sequence from CHOPCHOP, you can use the same sequence to design the primers for MiSeq. Anecdotally this seems to work well for most people on their first try.

Add miseq tags/overhangs to your primer sequence.

• Universal forward (F) tag: 5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG 3'
• Universal reverse (R) tag: 5' GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG 3'

These overhang sequences correspond to the Illumina nextera transposase overhangs and will be compatible with Illumina kits using Nextera XT

(Optional) Test primers (including tag) for secondary structure formation (e.g., dimers and hairpins) using this online IDT OligoAnalyzer tool

NB. It is unlikely that you will have high scores due to the length of the primers and amplicon restrictions. Just pick the best

Order primers - standard desalted primers are fine for this application.

If the primers arrive as dry pellets, reconstitute the primers in autoclaved distilled or nuclease-free water to create a stock solution and working solution.

• 100micromolar (µM) stock solution by adding nuclease-free water. If nMoles of your primer (check the tube), resuspend the dry pellet in µL of water
• 10micromolar (µM) working solution

Run a PCR

I have designed a handy master mix calculator master mix calculator for Taq , Platinum Taq and Pre-mix Schier PCR mix.

Here is an example of a PCR mix for a single well with a total volume 10µL total volume

A	B
Autoclaved, distilled (nuclease free) water	6.46 μL
10X PCR Buffer, -Mg	1 μL
50 mM MgCl2	0.3 μL
10 mM (each) dNTP Mix	0.2 μL
10 μM forward primer	0.5 μL
10 μM reverse primer	0.5 μL
Taq DNA Polymerase	0.04 μL
Template DNA (from 100μL HotShot)	1 μL

Note, Taq is unstable and should be taken out of the freezer for the shortest amount of time possible. It is sensible to prepare PCR mix on ice.

Suggested PCR programme:

1. 95°C , 0h 5m 0s
2. 95°C , 0h 0m 30s (Denaturation step)
3. Temperature gradient* around 60°C , 0h 0m 30s (Annealing step)
4. 72°C , 0h 0m 30s (Extension step)
5. Repeat steps 2-4, 25-35 times
6. 72°C , 0h 5m 0s (Final extension step)
7. 10°C hold

*For your test run, you should use a gradient PCR to test the ideal temperature for your primers (Note. By default, CHOPCHOP designs primers for an optimal melting temperature of 60°C). We usually run a gradient PCR for five different temperatures, with 60°C being optimal, then varying 1°C-1.5°C above and below.

Run on a 1% agarose gel

Amplify up PCR products to analyse by MiSeq.

I have designed a handy master mix calculator.

Here is an example of a PCR mix for a single well with total volume 10µL total volume

A	B
Autoclaved, distilled (or nuclease free) water	7 μL
10X PCR Buffer, -Mg	1 μL
50 mM MgCl2	0.3 μL
10 mM (each) dNTP Mix	0.2 μL
10 μM forward primer	0.2 μL
10 μM reverse primer	0.2 μL
Platinium Taq DNA Polymerase	0.1 μL
Template DNA	1 μL

Note, Taq is unstable and should be taken out of the freezer for the shortest amount of time possible. It is sensible to prepare PCR mix on ice.

Suggested PCR programme:

1. 95°C , 0h 5m 0s (Initial Denaturation Step)
2. 95°C , 0h 0m 30s (Denaturation step)
3. 60°C* 0h 0m 30s (Annealing step)
4. 72°C , 0h 0m 30s (Extension step)
5. Repeat steps 2-4, 25-35 times
6. 72°C , 0h 5m 0s (Final extension step)
7. 10°C hold

*Or T_m of your given primer pair

Run on a 1% gel to confirm a single band at the anticipated weight. This is just to check the PCR worked. To save time, just run a couple of your samples.

Clean up your samples

Traditional column-based PCR clean-up kits would work fine, but we recommend using ExoSAP, . Although it is more expensive (~£30 per plate), it is much more practical, especially for many samples.

1. Transfer 5µL of your PCR product into a new plate
2. Add 2µL of ExoSAP reagent to each well
3. (Vortex optional) Spin down & run the ExoSAP programme thermocycler.

• 0h 15m 0s at 37°C – Degrade the remaining primers and nucleotides
• 0h 15m 0s at 80°C – Inactivate ExoSAP

Check the concentration of your clean PCR product. This can be done using Nanodrop or Qubit. I would recommend Qubit due to its superior accuracy and reliability. We recommend only testing a few of your samples to save time and money.

We usually use the following kit from Thermo Fisher, which comes with a working solution.

Setup and label the lids of the required number of assay tubes for your samples plus two standards (Use thin-wall, clear, 0.5-mL Qubit Assay PCR tubes (Cat. No. Q32856)).

1. Add 190µL Qubit™ 1X dsDNA working solution to each standard tube
2. Add 10µL of each Qubit standard to the appropriate standard tube
3. Add 199µL Qubit™ 1X dsDNA working solution to each sample tube
4. Add 1µL of each sample to the appropriate tube All tubes should have a final volume of 200µL

Read concentration using the Qubit machine and note them down.

Prepare your samples for miseq:

You need to submit a minimum of 6µL at a final concentration of 15-25 ng/μL