PCR-NGS for RNA viruses

Tomoki Yoshikawa, Masayasu Misu, Satoko Sugimoto, Yuki Takamatsu, Takeshi Kurosu, Yukiteru Ouji, Masahide Yoshikawa, Masayuki Shimojima, Hideki Ebihara, Masayuki Saijo

Published: 2023-02-11 DOI: 10.17504/protocols.io.x54v9d361g3e/v1

Abstract

This PCR-NGS were optimized for an NGS machine, MinION. These methods do not require nucleic acid amplification with virus-specific PCR primers, physical viral particle enrichment, and RACE.

These methods enable whole RNA viral genome sequencing by combining the following techniques:

Removal of unwanted DNA and RNA other than the RNA viral genome by nuclease treatment.
The terminal of viral genome sequence determination by barcoded linkers ligation.
Amplification of the viral genomic cDNA using ligated linker sequences-specific PCR.

This method can be exploited to determine any whole RNA viral genomes (i.e., single-stranded, double-stranded, positive-stranded, negative-stranded, non-segmented or multi-segmented genomes).

Before start

This method was only confirmed to work with the working stocks that contain isolated RNA viruses at least 3.0 × 10⁵ TCID₅₀ per ml.

It is recommended to check no bacterial contamination(e.g., Mycoplasma spp.).

Steps

Preparation for virus supernatant

Centrifuge the working stock virus to remove debris.

6000x g

Transfer 180µL virus supernatant to a 1.5ml screw cap tube.

Unwanted DNA and RNA mainly originating from the virus-infected cells are digested using.

3.1.

Total 201 μl reaction

180µL virus supernatant
20µL 10X Micrococcal Nuclease Reaction Buffer
1µL Micrococcal nuclease

Mix by pipetting and spin down.

37°C 1h 0m 0s

The viral RNA extraction

The viral genomic RNA extraction is performed using .

4.1.

Add 400µL of binding buffer (with 4µL PolyA carrier RNA).

Mix gently by ~5 times pipetting and flicking thoroughly the tube, and spin down.

Room temperature 0h 10m 0s

4.2.

Transfer the sample to a High Pure Filter Tube.

8000x g

Discard the flow-through liquid and Collection Tube, and insert the Filter Tube into a new Collection Tube.

4.3.

Add 500µL of inhibitor removal bo transfer the sample to a High Pure Filter Tube.

8000x g

Discard the flow-through liquid and Collection Tube, and insert the Filter Tube into a new Collection Tube.

4.4.

Add 450µL of wash buffer.

8000x g

Discard the flow-through liquid and Collection Tube, and insert the Filter Tube into a new Collection Tube.

4.5.

Add 450µL of wash buffer.

13000x g and discard the flow-through liquid.

Discard the Collection Tube and insert the Filter Tube into a 1.5 ml tube( ).

4.6.

Add 50µL Elution Buffer.

13000x g

Note

The eluted RNA can be stored at -80℃.

Remove unwanted DNA

Unwanted DNA mainly from the virus-infected cells in the RNA sample is digested using a .

5.1.

Total 56 μl reaction

50µL the eluted RNA
5µL 10X reaction buffer
1µL DNase I

Mix gently by pipetting and spin down.

37°C 0h 30m 0s

The viral RNA is purified using NucleoSpin RNA Clean-up XS - Takara, Catalog #740903.10.

6.1.

Add equal volume 56µL of Buffer RCU and mix gently.

6.2.

Transfer the sample to a NucleoSpin RNA XS Column.

11000x g

6.3.

Wash the column by 400µL Buffer RA3.

11000x g

Discard the flow-through liquid and Collection Tube, and insert the NucleoSpin RNA XS Column into a new Collection Tube.

6.4.

Wash the column by 200µL Buffer RA3.

11000x g

Discard the flow-through liquid and Collection Tube, and insert the NucleoSpin RNA XS Column into a Nuclease-free Collection Tube(1.5 ml).

6.5.

Add 10µL RNase-free H₂O.

11000x g

Transfer the sample to a 0.2 ml PCR tube - .

cSP6-polyA Linker DNA ligation

The viral RNA is ligated with cSP6-polyA Linker DNA using .

The RNA is ligated to the 3' end with the barcoded(complementary sequence of SP6 (cSP6)) polyA linker DNA. It is able to identify the 3’ terminal viral genome sequence. The PolyA sequence is required for reverse transcription for ONT kit (SQK-SQK-PBK004/PCS109).
Note
The cSP6-polyA linker DNA (5'-5rApp-CTATAGTGTCACCTAAATCAAAAAAAAAAAAAAAAAAAA-3ddC-3'), which is pre-adenylated at the 5' terminal (5rApp), and consists of the complementary sequence of SP6 (CTATAGTGTCACCTAAATC), oligo (dA) 20, and dideoxycytidine (3ddC) at the 3' terminal, was synthesised for 3' linker ligation by Integrated DNA Technologies (Coralville, IA).

7.1.

Total 20 μl reaction

10µL Purified RNA
1µL 10 μM the cSP6-polyA linker DNA
2µL 10X T4 RNA Ligase Reaction Buffer
6µL 50% PEG8000 solution
1µL T4 RNA Ligase 2, truncated KQ

Mix gently by pipetting and spin down.

Incubation 25°C 0h 15m 0s

The viral RNA purification by NucleoSpin RNA Clean-up XS - Takara, Catalog #740903.10.

Fill the sample to 100 μl with 80 μl TE (pH 8.0) and add 100 μl (equal volume) of Buffer RCU.

Eluted by 10 μl of RNase-free H₂O and transfer the sample to a 0.2 ml PCR tube.

Reverse transcription with strand-switching, SQK-PBK004/ PCS109

The viral RNA is reverse transcribed using Maxima H Minus Reverse Transcriptase - Life Technologies, Catalog #EP0752, PCR barcoding kit - Oxford Nanopore Technologies Catalog #SQK-PBK004, cDNA-PCR Sequencing kit - Oxford Nanopore Technologies Catalog #SQK-PCS109.

The following protocol is modified based on the cDNA-PCR Sequencing protocol (PCSB_9086_v109_revK_14Aug2019) provided by Oxford Nanopore Technologies website.

Note

<cDNA-PCR Sequencing kit (SQK-PCS109)>RT primer and strand-switching primer VN primer (VNP): 5' - 5phos/ ACTTGCCTGTCGCTCTATCTTCTTTTTTTTTTTTTTTTTTTTVN - 3'Where V = A, C, or G, and N = A, C, G, or TStrand-Switching Primer(SSP): 5' - TTTCTGTTGGTGCTGATATTGCT mGmGmG - 3'

9.1.

Set up pre-mixture 1

9µL RNA (~ 50ng)
1µL VN primer (VNP)
1µL 10mM dNTP -

Mix gently by flicking the tube, and spin down.

65°C 0h 5m 0s and 4°C 0h 1m 0s

9.2.

Set up pre-mixture 2

11µL pre-mixture 1
4µL 5X RT buffer
1µL nuclease-free H₂O
1µL RNase OUT -
2µL Strand-Switching Primer(SSP)

Mix gently by flicking the tube, and spin down.

42°C 0h 2m 0s

9.3.

Add 1µL Maxima H Minus Reverse Transcriptase and mix gently by flicking the tube, and spin down. (Total 20 μl reaction).

42°C 1h 30m 0s

85°C 0h 5m 0s

PCR with barcoding

10.

PCR enzyme;

KOD One PCR Master Mix - TOYOBO Catlog #KMM-101

or

10.1.

PCR reaction is as follows:

5µL cDNA
3µL LWB (barcoding primer)
42µL nuclease-free water
50µL PCR enzyme (KOD One / Q5) The reaction mix should be aliquoted in appropriate portions in accordance with the PCR machine used.

Step Temperature Time

Heat Activation 98°C 0h 0m 15s

30 cycles of 3 steps

Denaturation 98°C 0h 0m 10s

Annealing 62°C 0h 0m 5s

Extension 68°C 35sec or 5 sec/kb

                                     `68°C`        `0h 2m 0s`

Note

A 35 sec extension is used for viruses with a genome size of less than 7 kb/segment, whereas a 5 sec/kb is employed in other cases.

Step Temperature Time

Heat Activation 98°C 0h 0m 30s

30 cycles of 3 steps

Denaturation 98°C 0h 0m 10s

Annealing 72°C 0h 0m 10s

Extension 72°C 40 sec/kb

                                     `72°C`        `0h 2m 0s`

11.

Add 1µL .

37°C 0h 15m 0s

80°C 0h 15m 0s

12.

The PCR product is purified using .

Prepare AMpure XP reagent for use; resuspend by vortexing.

Transfer amplified DNA sample to 1.5ml low binding tube.

12.1.

Add 80µL AMPure XP reagent and mix by pipetting.

Incubate on rotor mixer.

0h 5m 0s Room temperature

12.2.

Spin down and pellet on a magnet. Wait for 0h 1m 0s and pipette off the supernatant.

12.3.

Wash three times by 200µL 70 % ethanol and remove the ethanol using a pipette and discard.

12.4.

Spin down and pipette off any residual ethanol.

12.5.

Resuspend pellet in 12µL Elution Buffer (EB). 37°C 0h 3m 0s and tapping occasionally.

Incubate on rotor mixer.

0h 7m 0s

12.6.

Spin down and pellet the beads on the magnet until the elute is clear and colourless.

12.7.

Remove retain 12µL elute into a new tube.

13.

DNA concentration is measured using a Qubit 4 Fluorometer with .

199µL 1X working solution
1µL DNA

Mix by vortexing.

Incubate 0h 2m 0s Room temperature and measure.

Note

The molar quantity of cDNA in the sample can be converted from the concentration through the utilization of the viral genome length or the mean viral genome length if the viral genome is segmented.

Adaptor Ligation

14.

Add 1µL of Rapid Adaptor (RAP)(SQK-PBK004, SQK-PCS109) to 11µL library DNA(total approximately 100 fmol).

Mix gently and incubate 25Room temperature 0h 5m 0s.

Sequencing by MinION

15.

Sequencing according to the manufacturer's instructions.

PCR-NGS for RNA viruses

Abstract

Before start

Steps

Preparation for virus supernatant

The viral RNA extraction

Remove unwanted DNA

cSP6-polyA Linker DNA ligation

Reverse transcription with strand-switching, SQK-PBK004/ PCS109

PCR with barcoding

Adaptor Ligation

Sequencing by MinION

推荐阅读