NFIA is a gliogenic switch enabling rapid derivation of functional human astrocytes from pluripotent stem cells

Maintain human pluripotent stem cells (both embryonic and induced) on vitronectin-coated dishes in Essential 8 (E8) medium (Thermo) as previously described.

Purchase induced PSCs.

Cells were used for differentiation between passages 30–50 and passaged twice every week. Cells were subjected to mycoplasma testing every 1344h 0m 0s-2016h 0m 0s .

Maintain Neural stem cells, LTNSCs and glial progenitors on poly-l-ornithine/laminin/fibronectin-coated dishes in NSC medium consisting of N2 media with 10µg/mL Fibroblast growth factor 2 (FGF2), 10µg/mL epidermal growth factor (EGF) and 1:1,000 B27 supplement. LTNSCs were used between passages 15–20 and passaged every week.

Maintain Human pluripotent stem cell-derived astrocytes on poly-l-ornithine/laminin/fibronectin-coated dishes in astrocyte media consisting of N2 medium with 10µg/mL (R&D Systems, No. 259-HE). After sorting, CD44-positive cells were passaged every week for 4 weeks and then every other week or until astrocyte processes started to detach.

Initially maintain commercial fetal astrocytes (Sciencell) in a commercial medium containing serum (Sciencell). Switch the serum-containing medium to N2 with 10µg/mL for at least two passages before performing the experiments.

Maintain human pluripotent stem cell-derived cortical excitatory neurons on poly-l ornithine / laminin / fibronectin-coated dishes in neurobasal medium with brain-derived neurotrophic factor (BDNF), ascorbic acid, glial cell line-derived neurotrophic factor (GDNF) and cyclic adenosine monophosphate. Change more than 50% of the medium every week.

Dorsal forebrain patterning. Dissociate human PSCs into single cells, and 2.5–3.0 × 10⁵ cells per cm2 were plated onto Matrigel (BD Biosciences)-coated dishes in E8 containing 10micromolar (µM) (No. Y-27632).

The following day (day 0), switch the cells to Essential 6 (E6) medium containing 100micromolar (µM) LDN193189 (LDN, Stemgent) and 10micromolar (µM) SB431542 (SB, Tocris; LSB).

Change medium every day for nine additional days (d8) as previously described.

To better promote an anterior forebrain fate (that is, for iPSCs), we add 2micromolar (µM) of XAV939 (Stemgent) in addition to LSB for 72h 0m 0s (d0–2) then from d3–8 maintained the cells in LSB without XAV939.

From d8, dissociate the cells with Accutase for 0h 30m 0s at 37°C and passed through a 40 μm cell strainer.

Resuspend the cells in N2 medium with brain-derived neurotrophic factor (BDNF), ascorbic acid, Sonic Hedgehog (SHH) and fibroblast growth factor 8 (FGF8) (N2-BASF), and plated at 5 × 10⁵ cells on air-dried poly-l-ornithine/laminin/fibronect in-coated plates in 20µL droplets.

Incubate the droplets at 37°C for 0h 15m 0s - 0h 20m 0s . N2-BASF8 medium + 10micromolar (µM) ROCKi medium was overlaid on the droplets and the medium changed every day. Rosette formation was expected within 48h 0m 0s-72h 0m 0s (d12).

Following rosette formation, dissociate cells with Accutase and replated at relatively high density (3.5 × 10⁵ cells per cm²) to prevent spontaneous differentiation. Assay the cultured cells for correct regional patterning,

differentiated or frozen.

Similar to the dorsal forebrain, plate 2.5–3.0 × 10⁵ cells per cm² onto Matrigel (BD Biosciences)-coated dishes in hPSC knockout serum replacement (KSR)-based medium containing 10micromolar (µM) ROCK inhibitor and 10µg/mL FGF2.

The following day (day 0), switch the cells from a progressive gradient of KSR to N2 medium containing 100micromolar (µM) LDN193189 and 10micromolar (µM) SB431542 (LSB).

The following day (day 1), switch the medium to LSB with 1micromolar (µM) of retinoic acid and 1micromolar (µM) of purmorphamine and maintained for an additional 264h 0m 0s (d12).

Dissociate spinal cord progenitors with Accutase for 0h 30m 0s at 37°C and pass it through a 40 μm cell strainer. Plate the cells at 2.5 × 10⁵ cells per cm² on poly-l-ornithine/laminin/fibronectin-coated plates and assayed for correct regional patterning, differentiated or frozen.

Initially, differentiated hPSCs using the method employed for dorsal forebrain NSCs. After initial regional patterning, differentiated cells were dissociated using 10% dispase for 0h 10m 0s .

Separated the cells into clumps and resuspend in N2 medium containing 20µg/mL FGF2 and cultured in sterile, non-tissue culture-treated dishes.

Cells were expected to form a high number of neurospheres, and by 3-5 days neural rosette formation within the spheres should be apparent. Having purified the neurosphere cultures, they were landed on poly-l-ornithine / laminin / fibronectin-coated plates and cultured in N2 with 10µg/mL FGF2, 10µg/mL EGF and 1:1,000 B27 supplement (NSC media).

Observe Rosette-stage NSC outgrowth to confluency and then pass at high density (approximately 1:3) over 2-3 months.

Cells maintaining neuroepithelial morphology by passage 10 in NSC media were kept and analyzed for early NSC markers and differentiation potential.

Clone NFIA and SOX9 from cDNA using hPSC-derived astroglial progenitors (d90). Digest FUW-tetO-GFP (Addgene, No. 30130) with the restriction enzyme EcoRI to remove the GFP fragment, and either insert NFIA or SOX9 using traditional ligation cloning.

Plasmids containing NFIA, SOX9, FUCCI-O or M2-rtTA (Addgene, No. 20342), the packaging vector psPAX2 (Addgene, No. 12260) and transfect the envelope pMD2.G (Addgene, No. 12259) into 293 T cells X-tremeGene HP (Sigma) at a molar ratio of 1:2:1.

Harvest virus at 48 and 72h 0m 0s post-transfection and concentrate it using AMICON Ultra-15 Centrifugal Filter Units (Millipore).

Plate NSCs at 3.5 × 10⁵ cells per cm² on poly-l-ornithine/laminin/fibronectin-coated dishes.

Incubate the cells with viral particles generated (as described above) for 16h 0m 0s-20h 0m 0s .

Switch the medium to NSC medium with 1µg/mL -2µg/mL doxycycline and daily medium change for a minimum of 120h 0m 0s .

Detach cells using 0.05% trypsin and wash several times in preparation for CD44 labeling.

For both live and fixed sorting, dissociate cells using 0.05% trypsin and washed twice with phosphate buffered saline (PBS).

Fixed GFAP and CD44 analysis.

Using the BD Cytofix/Cyto Perm kit (BD), resuspend 1 × 10⁶ cells in 1mL Cytofix and placed On ice for 1h 0m 0s .

Wash the cells twice with 1× Cyto Perm Buffer and resuspended in 100µL of 1× Cyto Perm Buffer.

Add Alexa 647-conjugated CD44 (Biolegend) and unconjugated GFAP (Dako) to the cells, as described by the manufacturer, and incubate for 0h 40m 0s On ice .

Wash the cells twice with 1× Cyto Perm Buffer and resuspended in 100µL of 1× Cyto Perm Buffer for secondary labeling.

For labeling of GFAP, add Alexa 488 or 555 to the cells for 0h 30m 0s On ice . Wash cells twice with 1× Cyto Perm Buffer and submit for analysis.

Live CD44 sorting:

Resuspend approximately 4–5 × 10⁶ cells in 100µL of sort buffer (2% fetal bovine serum, 1millimolar (mM) EDTA in PBS), and incubate CD44 conjugated with Alexa 647, as per the manufacturer’s instructions, On ice for 0h 20m 0s - 0h 30m 0s .

Wash cells twice with sort buffer and submitted to the sorter.

Maintain CD44-positive cells in astrocyte induction medium (N2 with 10µg/mL heparin-bound EGF (R&D Systems) and 10µg/mL leukemia inhibitory factor (Peprotech) without doxycycline.

Fix cells in PBS containing 4% paraformaldehyde for 0h 10m 0s , permeabilized using PBS with 0.5% Triton-X for 0h 5m 0s and stored in PBS with 0.2% Tween-20.

Contain the blocking solution 5% donkey serum in PBS with 0.2% Tween-20. Dilute primary antibodies in the blocking solution and typically incubate at 4°C .

Conjucate Secondary antibodies to either Alexa 488, Alexa 555 or Alexa 647 (Thermo) were added to the cells

with incubation for 0h 30m 0s .

Identify nuclei by staining the cells with 4′,6-diamidino-2-phenylindole (DAPI, Thermo). A list of antibodies used in this study is given in Supplementary Table 3.

Harvest and lyse cells with RIPA buffer, and quantify protein using Precision Red (Cytoskeleton, Inc).

Load 10µg of protein to analyze protein expression. Full scans of blots for Fig. 2b (Supplementary

Fig. 22), Fig. 4f (Supplementary Fig. 23), Fig. 4k (Supplementary Fig. 24) and Supplementary Fig. 7c (Supplementary Fig. 25) are available.

RNA sequencing. Isolate RNA as previously described. Submit total RNA to the Memorial Sloan Kettering Cancer Center (MSKCC) Genomics Core for paired-end sequencing, aiming for 30–40 million reads.

Trim raw FASTQ files for adapters and aligned to the ENSEMBL GRCh38 genome build using STAR 2.5.0.

Generate and import matrices from the aligned files using HTSeq into DESeq2 for further analysis using a standard pipeline.

A list of the normalized read counts represented in Fig. 1 and Supplementary Fig. 8 can be found in Supplementary

Table 1, and a list of genes expressed from all samples in Fig. 4 can be found in Supplementary Table 2.

ATAC sequencing:

Raw FASTQ files were aligned to the hg19 genome build using Bowtie2. Perform comparative analysis of alignment using the deepTools software package. Perform motif analysis and peak annotation using HOMER software and visualized using the IGV browser.

Upload all FASTQ files and Supplementary files to National Center for Biotechnology Information Gene Expression Omnibus under accession code GSE104232.

Plate astrocytes at 2 × 10⁴ cells per cm² and treated with 3µg/mL IL-1α (Sigma), 30µg/mL tumor necrosis factor (Cell Signaling Tech) and 400µg/mL C1q (MyBioSource) for 24h 0m 0s .

Isolate the medium and spun down to remove debris, and measure C3 levels using the Human Complement C3 ELISA Kit (Abcam) as per the manufacturer’s instructions.

Isolate cells with dissociated nuclei using resuspension buffer (10millimolar (mM) Tris-HCl, 30millimolar (mM) NaCl, 20millimolar (mM) MgCl2) and subsequently the resuspension buffer with 1% NP-40 for cell cycle analysis.

Add propidium iodine (250µg/mL) to the cells followed by analysis with FACS.

Analyse a minimum of 10,000 events per condition. Data acquired were imported and analyzed by Flowjo software.

Perform all surgeries according to National Institutes of Health guidelines and approve it by the local Institutional Animal Care and Use Committee, the Institutional Biosafety Committee and the Embryonic Stem Cell Research Committee. A total of eight (or 20) [CF1] NOD-SCID IL2-Rgc null mice (20–35 g; Jackson Laboratory) received cell transplantation.

Anesthetize mice with isoflurane 5% at a maintenance flow rate of 2–3%. Transplant a total of 7 × 10⁴ NFIA-induced

astrocytes in 2µL through a 5µL Hamilton syringe at a rate of 1µl/min by an infusion pump attached to a stereotactic micromanipulator, into the genu of the corpus callosum (coordinates: AP +0.740, ML −1.00, DV −2.30 from bregma).

Transplant a total of 2 × 10⁵ LTNSC 2µL into the subcortical gray matter, striatum (coordinates AP +0.500, ML −1.90, DV –3.20 from bregma).

Transplant a total of 7.5 × 10⁴ H1-GFP-derived astrocytes in 2µL into the genu of the corpus callosum (coordinates: AP +0.740, ML –1.00, DV –2.30 from bregma).

Sacrify the mice at 1, 6 and 12 weeks after transplantation for immunohistochemical analysis.

Euthanize mice were euthanized with an overdose of pentobarbital given intraperitoneally, then transcardially perfused with PBS followed by paraformaldehyde 4%.

Remove brains after gentle dissection, maintained overnight in 4% paraformaldehyde then soaked in 30% sucrose for 48h 0m 0s -72h 0m 0s .

Perform brain coronal sectioning (030µm at -20°C) by cryostat after embedding with Optimal Cutting Temperature (OCT) (Sakura Finetek).

Plate Human pluripotent stem cell-derived neural stem cells, astrocytes or primary astrocytes (Sciencell) onto poly-l-ornithine/laminin/fibronectin-coated 0.5 mm black ΔT dishes (Bioptechs) and use for calcium imaging as previously described between days 60 and 120.

Incubate Cultures with 5micromolar (µM) Fura-2 (Thermo) for 0h 30m 0s at 37°C and dishes were mounted on a ΔT Heated Lid w/Perfusion system (Bioptechs).

Perfuse cultures with normal Tyrode’s solution (7.4) containing 125millimolar (mM) NaCl, 5millimolar (mM) KCl, 25millimolar (mM) glucose, 25millimolar (mM) HEPES, 1millimolar (mM) MgCl2, 2millimolar (mM) CaCl2 and 0.1% (w/v) bovine serum albumin.

Supplement cultures with glutamate (100micromolar (µM) ), ATP (30micromolar (µM) ) or KCl (65millimolar (mM)) for 0h 1m 0s and imaged every 30 s at 340 and 380 nm at a minimum of seven positions.

Analyse time-lapse images using FIJI (ImageJ) by calculating the signal ratio between 380 and 340 nm.

Derive cortical neurons by differentiating hPSCs towards a neuro-ectodermal fate (see above). Dissociate Neuro-ectodermal cells and replate to generate neural rosettes, and further differentiate into neurons by treatment with 10micromolar (µM) of a γ-secretase inhibitor (DAPT).

Replate neurons and assay for maturation markers or glutamate excitoxicity with or without astrocytes.

For glutamate excitotoxicity studies, plate 100,000 neurons per cm² on poly-l-ornithine/laminin/fibronectin dishes in N2 medium with BDNF, ascorbic acid and GDNF.

Add NFIA-induced astrocytes at 150,000 cells per cm² and co-culture for an additional 120h 0m 0s .

Treat cells with 100µm or 500µm (final) l-glutamate for 1h 0m 0s in Hanks’ buffered salt solution and recover in N2 medium with BDNF, ascorbic acid and GDNF.

Add resazurin 48h 0m 0s after glutamate treatment to determine cell viability.

Treat LTNSCs infected with NFIA with dox for 120h 0m 0s and sorte for CD44.

Isolate cells were and perform bisulfite conversion using the EZ DNA Methylation-Direct Kit (Zymo) as

described by the manufacturer.

Primers for the regions of the GFAP STAT3 binding site were described previously.

Briefly, P1 and P2 correspond to –1,500 bp from the start site of GFAP (P1 forward: 5′ AGGAGGGTTGTTTGTTTTTTAGAA, P1 reverse: 5′ CCCTTCCTTATCTAACCTCCCTATA and P2 forward: 5′ GTAGATT

TGGTAGTATTGGGTTGGT, P2 reverse: 5′ CCCTCACCCATTTATATCCTTAAA.

Amplify the GFAP promoter region using ZymoTaq Premix (Zymo) and cloned into the TOPO Zero Blunt vector (Invitrogen). Sent a minimum of ten colonies per condition for sequencing.

Perform whole-cell recordings as described previously, with slight modifications. Briefly, visualize neurons using a Zeiss microscope (Axioscope) equipped with a ×4 objective and a ×40 water immersion.

Record neurons at 23°C-24°C .

Measure input resistance from voltage response elicited by intracellular injection of a current pulse

(−100 pA, 200 ms).

Filter low-pass membrane voltage at 5 kHz and digitize at 10 kHz, using a Multiclamp 700B amplifier connected to a DigiData 1322 A interface (Axon Instruments) using Clampex 10.2 software (Molecular Devices).

Calculate liquid junction potentials and correct offline.

During recording, perfuse neurons with freshly prepared artificial cerebrospinal fluid (126millimolar (mM) NaCl, 26millimolar (mM) NaHCO3, 3.6millimolar (mM) KCl, 1.2millimolar (mM) NaH₂PO₄, 1.5millimolar (mM) MgCl2, 2.5millimolar (mM) CaCl2 and 10millimolar (mM) glucose), and saturate the solution with 95% O₂–5% CO₂.

Pipette solution for all recordings contained 140millimolar (mM) CsCl, 10millimolar (mM) NaCl, 10millimolar (mM) HEPES, 0.5millimolar (mM) EGTA, 3millimolar (mM) Mg-ATP, 0.2millimolar (mM) Na-GTP and 10millimolar (mM) Na2-phosphocreatine, pH adjust to 7.3 with CsOH.

Add Bicuculline methochloride (20micromolar (µM) , Tocris), 1micromolar (µM) strychnine HCl (Sigma) and 0.5micromolar (µM) tetrodotoxin (TTX, Alomone Labs) to the artificial cerebrospinal fluid for mEPSC recordings to block gamma-aminobutyric acid receptors, glycine receptors and Na+ channels, respectively.

Hold neurons at –80 mV and continuous recording of mEPSCs was made using Axoscope software (Molecular

Devices).

Perform data processing and analysis using MiniAnalysis (Synaptosoft) and Clampfit 10 (Molecular Devices). Detect Events by setting the threshold value, followed by visual confirmation of mEPSC detection.

Perform statistical analysis using Student’s t-test or Mann–Whitney rank sum test as necessary, with a significant difference at P < 0.05. Data are expressed as mean ± standard error.