MecA detection Protocol
Abdullahi Hassan Kawo, Kabir Umar, Idris Abdullahi Nasir, Abdurrahman E Ahmad, Abduqadir Magaji Magashi, Abubakar Umar Anka
Abstract
Polymerase chain reaction (PCR) was conducted for the detection of MecA gene from the Staphylococcus aureus Isolated from both healthcare workers and burns and wound patients using the primers listed in table 3.1. A total PCR reaction volume of 25µl containing primers 2 µl, Pre-mix 15 µl, sample 2 µl, and water 6 µl was used, and a cycling condition, with Initial denaturation at 94 ºC for 5 min, and 30 cycles of denaturation at 94 ºC for 30 sec, annealing at 55 ºC for 30 sec and elongation at 72 ºC for 1 min and final extension 72 ºC 10 min was adopted. PCR amplification was conducted in a thermal cycler (MyCycler Thermal Cycler, Bio-Rad, Portugal) after which agarose gel electrophoresis was run to detect the presence (Band size) or absence of MecA gene as described by Poulsen et al ., 2003
MecA gene primers
| A | B | C |
|---|---|---|
| Gene | Primers (3’-5’ | Amplicon Size (BP) |
| mecA | F: GGGATCATAGCGTCATTATTC R: AACGATTGTGACACGATAGCC | 527 |
