KAT8 compound inhibition inhibits the initial steps of PINK1-dependant mitophagy

Maintain cells in culture in a humified 5% CO₂ incubator at 37°C in Dulbecco's modified Eagle's medium (DMEM, Gibco, 11995-065) supplemented with 10% heat-inactivated foetal bovine serum (FBS, Gibco). Change cell medium every 3 days.

Split cells at 75% to 90% confluency using 2mL of Trypsin.

Dilute each compound in DMSO to reach concentrations determined according to their speculated toxicity and IC₅₀, 10micromolar (µM) for NU9056 and 100micromolar (µM) for MG149.

Treat cells with DMSO, 10micromolar (µM) NU9056, or 100micromolar (µM) MG149 for 6h 0m 0s before collecting / fixing for downstream experiments.

Treat cells with either DMSO or 10micromolar (µM) oligomycin/ 10micromolar (µM) antimycin for 3h 0m 0s to induce mitophagy before collecting / fixing for downstream experiments.

Incubate cells at -80°C in mitochondrial homogenization buffer (250mM sucrose, 1mM EDTA, 10mM Tris (pH 7.4) supplemented with protease and phosphatase inhibitors).

Thaw, scrape into 1.5mL centrifuged tubes, and triturate 20x, keeping samples On ice .

Freeze tubes at -80°C for 1h 0m 0s , then thaw On ice .

Remove cell debris / non-lysed cells by centrifugation 1500rcf,4°C .

Centrifuge the supernatant 12500x g,4°C to collect the mitochondrial enriched pellet (aka the mitochondrial fraction) and save the supernatant (aka the cytoplasmic fraction).

Centrifuge the cytoplasmic fraction 12500x g,4°C to remove membrane contamination and wash the mitochondrial fraction twice in 500µL of fractionation buffer (12500x g,4°Cx 2) to remove cytoplasmic contaminants.

Determine the relative ratios of sample differences for the mitochondrial enriched fraction using the protein concentration of the cytoplasmic fraction (BSA assay). Re-suspend the mitochondrial enriched pellet accordingly using 1x NuPAGE® LDS sample buffer supplemented with 10 mM dithiothreitol (DTT).

Sonicate the mitochondrial fraction (10 microns power amplitude for 2 x 10 seconds, "flick" in

between) and heat to 70°C for 0h 10m 0s.

Lyse cells in whole-cell lysis buffer (50mM Tris (pH 7.4), 0.1mM EGTA, 1mM EDTA, 0.27M Sucrose, 1% triton-x-100, supplemented with protease and phosphatase inhibitors)On iceand incubated at -80°C.

Centrifuge the lysates 1600x g,4°C and protein quantify the supernatant by BSA assay.

Make LDS preps with 10 mM dithiothreitol (DTT), and heat to 70°C for 0h 10m 0s.

Separate the LDS preps (either after cell lysis or mitochondrial enrichment) by SDS-PAGE and transfer them to nitrocellulose membrane.

Incubate the membrane at 4°C with primary antibodies diluted in 3% milk in PBS-Tween.

Wash and incubate the membrane for 1h 0m 0s at Room temperature in secondary antibodies diluted in PBS-Tween.

Detect the protein bands using Odyssey CLx LI-COR.

Fix cells with 4% Paraformaldehyde (PFA, Sigma-Aldrich) for 0h 20m 0s atRoom temperature.

Remove PFA solution, block and permeabilize the cells with a mix of 10% FBS, 0.25% Triton X-100 in PBS for 1h 0m 0s at Room temperature .

Immunostain the cells with pUb(Ser65) and TOM20 primary antibodies diluted in 10% FBS/PBS for 2h 0m 0s at Room temperature.

Wash wells three times using PBS 1X and incubate with secondary antibodies for 1h 0m 0s at Room temperature , before washing again three times using PBS 1X.

Image cells on the Opera Phenix (Perkin Elmer), acquiring confocal z-stacks for multiple fields of view across 3 individual wekks per experimental condition, using the 40X water objective.

Seed POE-SHSY4Y cells in a 96-well CellCarrier Ultra plate.

For visualisation purposes, select brightness and contrast settings on the control and apply the same settings to all other conditions.

Normalise intensity measurements from imaging experiments for each independent, replicate experiment. Calculate the mean value from a minimum of 3 technical replicates for each condition of an independent, replicate experiment.

Incubate live cells in 25nanomolar (nM)TMRM Perform Tetramethylrhodamine, Methyl Ester, Perchlorate (TMRM) measurements in redistribution mode where a decrease in TMRM signal intensity is associated with mitochondrial membrane potential (ψm) depolarisation (confirmed post-imaging by treatment with 1 micromolar (µM) Carbonyl cyanide m-chlorophenyl hydrazone, CCCP, ψm depolarising agent).

Incubate live cells in 25 nanomolar (nM) TMRM (Sigma Aldrich) diluted in Hanks' Balanced Salt Solution (HBSS, Gibco) buffered with 10 millimolar (mM) HEPES (Sigma Aldrich), 7.4 for 00:40:00 at 37 °C.

68Image cells on the Opera Phenix (PerkinElmer) at 37 °C, acquiring confocal z-stacks for 27 fields of view across 3 individual wells per experimental condition using the 40X water objective, NA1.1.

Note

Excite TMRM with the 561 nm laser (50% power) and collect signal with 570-630nm emission filter.

Excite TMRM with the 561 nm laser (50% power) and collect signal with 570-630nm emission filter.

69Analyse images in an automated way using the Columbus 2.8 analysis system (Perkin Elmer) to measure the TMRM signal intensity of maximum intensity projections.

Incubate live cells in25nanomolar (nM) Tetramethylrhodamine, Methyl Ester, Perchlorate (TMRM) (Sigma Aldrich) diluted in cell media for 0h 40m 0s at 37°C and 4% CO₂.

Normalise integrated density measurements from Western blot experiments to control conditions.

Image cells on the Opera Phenix (PerkinElmer) at 37°C and 4% CO₂, acquiring confocal z-stacks for multiple fields of view across 3 individual wells per experimental condition using the 40X water objective.

Subject the data to a two-way ANOVA with Dunnett's post-hoc analysis for multiple comparisons, unless otherwise stated

Seed mt-Keima expressing POE SHSY5Y cells in a 96-well CellCarrier Ultra plate and treat them according to desired conditions (MG149, NU9056, O/A as described in ).

Before imaging, replace cell media with phenol-free DMEM + 10% FBS containing the treatments previously administered , and adding Hoechst 33342 (1:10000) to stain the nuclei.

Image cells immediately on the Opera Phenix (PerkinElmer) at 37°C with 5% CO₂, acquiring multiple single-plane fields of view, using the 63X water objective.

Extract total RNA from cells using the Monarch Total RNA Miniprep Kit (New England Bioscience) with inclusion of the optional on-column DNAse treatment.

Reverse transcribe RNA with SuperScript™ IV reverse transcriptase and random hexamers (Invitrogen).

Dilute the cDNA product then subject to quantitative real-time PCR (qPCR) using Power SYBR™ Green Master Mix (Applied Biosystems) and gene specific primer pairs on a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems).

A	B	C	D
	Sequence 5'-3'
Gene Target	Forward	Reverse	Product Size / bp
RPL18A	CCCACAACATGTACCGGGAA	TCTTGGAGTCGTGGAACTGC	180
PINK1	GTGGAACATCTCGGCAGGTT	CCTCTCTTGGATTTTCTGTAAGTGAC	129

List of primer pairs used for RT-qPCR of target genes

Calculate relative mRNA expression levels using the 2^−ΔΔCt method and RPL18A as the housekeeping gene.

Use a minimum of 3 biological replicates for each experiments (N numbers shown in legends refer to the number of replicate experiments).

• For each imaging experiments, calculate the mean values of every condition from a minimum of 3 technical replicates.

• Normalise intensity and integrated density measurements to control conditions.

Subject data to a two-way ANOVA with Dunnett's post-hoc analysis for multiple comparisons unless stated otherwise.

• Express data as the mean ± standard deviation (SD) from replicate experiments.

• Set statistical significance at a p-value of <0.05.

Seed mitoSRAI POE SHSY5Y cells in a 96-well CellCarrier Ultra plate and treat them according to desired conditions (MG149, NU9056, O/A as described in).

Fix cells as described in

Immunostain the cells with p62 primary antibodies diluted in 10% FBS/PBS for 2h 0m 0s at Room temperature.

Wash wells three times using PBS 1X and incubate with secondary antibodies for 1h 0m 0s at Room temperature , before washing again three times using PBS 1X.

Image cells on the Opera Phenix (Perkin Elmer), acquiring confocal z-stacks for multiple fields of view across 3 individual wells per experimental condition, using the 63X water objective.

PINK1 was functionally knocked out from the POE SH-SY5Y cell line through CRISPR-Cas9 editing by adapting previously published protocols (DOI: 10.15252/emmm.202013579)

A subconfluent 6-well dish of POE SH-SY5Ys were transfected with 1ug of each PINK1_Seq1 and PINK1_Seq2 sgRNA encoding pSpCas9(BB)-2A-GFP plasmid using lipofectamine 3000 (Invitrogen)

24 h post-transfection cells were trypsinised and subjected to fluorescence-activated cell sorting and clonal selection of GFP-positive cells: isolated clones were expanded and phenotypically screened for clones which did not show pUb(Ser65) signal after 1.5 h O/A treatment

Confluent wells of a 96-well were prepared for immunofluorescence staining of pUb(Ser65) with IRDye 800CW donkey anti-rabbit secondary

gDNA was extracted from a positive clone using the Wizard Genomic DNA Purification Kit (Promega) and subjected to whole genome sequencing (Novogene) which revealed homozygous 22 bp deletion and frameshift in exon 1 of PINK1 (c.156_177delGGGCGCGGAGCCTCGCAGGGTC, p.A54Sfs*46).

MitoSRAI cDNA was first PCR amplified from mitoSRAI_pcDNA3 with inclusion of 5′ EcoRI and 3′ NotI restriction sites

The PCR product was cloned into pLVX-EF1α-IRES-Puro using EcoRI and NotI restriction sites to generate pLVX-EF1α-mitoSRAI-IRES-Puro.

Lenti-X 293 T HEK cells cultured in DMEM 10% FBS media were transfected with pMD2.G, pCMVR8.74 and pLVX-EF1α-mitoSRAI-IRES-Puro at a 1:1:2 molar mass ratio using Lipofectamine 3000 (Invitrogen)

The next day, a full media change was performed using DMEM 10% FBS and cells cultured for further 24 

The lentivirus containing media was collected and diluted 1:2 with DMEM 10% FBS before filtering through 0.44 µm PES filters

1 × 106 POE SHSY5Ys were reverse transduced with the 1:2 lentivirus supernatant dilution in the presence of 10 µg/mL polybrene (Sigma Aldrich)

Bulk populations of cells stably expressing mitoSRAI were established through selection with 1 ug/mL puromycin (M P BIOMEDICALS UK)

Puromycin was maintained during routine culture but withdrawn when seeding for experimental assays.