All steps should be performed on ice or at 4°C.

Pre-chill all Dounces and pestles to 4°C in a fridge or on ice

Pre-chill all tubes.

For each sample you are processing, you will need:

(i) One 2mL per sample

(ii) Three per sample

(iii) one PCR tube per sample

(iv) One for filtration step per sample

Prepare buffers.

i) 6x Homogenization Buffer Stable Solution.

ii) 6x Homogenization Buffer Unstable Solution.

iii) 1x Homogenization Buffer Unstable Solution.

iv) ATAC-RSB

v) ATAC-RSB + 10% Tween

vi) 2X TD buffer

vii) 2X DF buffer

i) 6x Homogenization Buffer stable Solution.

A	B
Amount	Reagents
3 ml	1 M CaCl2
0.6 ml	3 M Mg(Ac)2
6 ml	1 M Tris pH 7.9
89.2 ml	molecular grade water

6x Homogenization Buffer Stable

ii) 6x Homogenization Buffer Unstable Solution.

A	B
Amount	Reagents
2.27084 ml	6x Homogenization Buffer stable
3.78 ml	100mM PMSF
0.28 ul	14.3 M B-mercaptoethanol
1/2 tablet	Protease inhibitor (cOmplete Mini)

6x Homogenization Buffer Unstable Solution

ii) 1x Homogenization Buffer Unstable Solution.

A	B
Amount	Reagents
2.166645 ml	6x Homogenization Buffer Unstable Solution
4.16 ml	1 M sucrose
2.6 ul	500 mM EDTA
130 ul	10.00% NP10
6.540755 ml	H2O

1x Homogenization Buffer Unstable Solution

iii) ATAC-RSB:

A	B
Amount	Reagents
500ul	1M Tris-Hcl ph 7.5
100ul	5M NaCl
150ul	1M MgCl2
49.25ml	H2O

ATAC-RSB

iv) ATAC-RSB + 10% Tween

A	B
Amount	Reagents
8 ml	ATAC-RSB
8 ul	10% Tween

ATAC-RSB + 10% Tween

v) 2X TD buffer

A	B
Amount	Reagents
2 ml	1 M Tris-Hcl pH 7.5
1 ml	1 M MgCl2
20 ml	100% Dimethyl Formamide

2X TD buffer (before the addition of dimethyl formamide, adjust the pH to 7.6 with 100% acetic acid)

vi) 2X DF buffer

A	B
Amount	Reagents
100 mM	HEPES (pH 7.2)
200 mM	NaCl
0.2 mM	EDTA
2 mM	DTT
2.00%	Triton X-100
20.00%	Glycerol

2X DF buffer

Tn5 assembly reaction

A	B	C
Primer	Sequence	Amount
Tn5-A primer	TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG	16 ul
Tn5-rev primer	CTGTCTCTTATACACATCT	16 ul

Tube A

A	B	C
Primer	Sequence	Amount
Tn5-B primer	GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG	16 ul
Tn5-rev primer	CTGTCTCTTATACACATCT	16 ul

Tube B

95°C to 25°C

cooling -0.1°C/second

~1 hour on PCR machine

Olgio Annealing program

TN5 Assembly

A	B
Amount	Reagent
25 ul	Tn5
15.5 ul	Tube A
15.5 ul	Tube B
33 ul	2X DF buffer

Tn5 Assembly Mix

Room temperature 1h 0m 0s

Tn5 from the Protein Science Facility at the Karolinska Institutet in Stockholm (Picelli et al. ,2014)

or

Materials for the cutting of tissue on dry ice.

• Gloves

• White warm gloves

• Dry ice

• Blades and handle

• Forceps

• Ethanol spray

• Cell culture dish

In the most sterile way possible, cut a small piece of tissue, half a pea size or so, and leave it in the petri dish with a marking on the lid, in the dry ice. Weigh it and cut again if needed.

Make sure to use the ethanol to clean everything and be careful not to cut yourself.

Add 2mL 1X HB buffer into the dounce, which is sitting in the ice.

Add 0.2µL 1 M DTT and and 1µL 100X Halt protease inhibitor

Place 20 mg frozen tissue into a pre-chilled 2 ml Dounce containing 1 ml cold 1x HB and let thaw for 0h 5m 0s.

Dounce with “A” loose pestle until resistance goes away (~10 strokes).

Put the A pestle into the beaker of water

Dounce with “B” tight pestle for 20 strokes.

Put the B pestle into the beaker of water

Pour everything from the dounce into a 30 um MACS smartstrainer which is sitting on top of a labelled 50 ml falcon tube sitting in ice.

Let it drip through for 10-15 minutes.

Transfer to a labelled 2mL Lobind Eppendorf tube, already cold from sitting in ice.

To pellet the nuclei, centrifuge 900rpm,4°C

Transfer the supernatant to a new tube without disturbing the pellet

Repeat the centrifugation

Discard supernatant

Resuspend the nuclei in 200µL of ATAC-RSB + 10% Tween

Count the amount of cells using the cell counter in the cell lab.

Put 10µL Trypton blue onto a piece of parafilm and mix with 10µL of the sample

Take 10µL of the mix and pipette into a cell counting cell

Measure on the cell counting machine, making sure to adjust for the smaller size of the nuclei.

The machine will think they are dead cells.

Calculate the amount of nuclei to use for the next step;

(500000 nuclei)

ATAC-seq requires 50,000 cells for the experiment. So for example if the number of nuclei is;

4.76 x 10⁷

then the calculation will look like this;

50000 / 47600 = 1.10

Turn on the thermomixer to 37°C

Add the calculated amount of cells into a2mL lobind eppendorf tube with 1 ml ATAC-RSB + 10% Tween.

So taking the example above one would take 1.10 ul of nuclei in the 200µL ATAC-RSB + 10% Tween to the new tube.

Centrifuge nuclei for 0h 10m 0s 900rcf,4°C

Here one can also save the nuclei for later. Simply spin the tube down with the new tube of diluted nuclei, discard the supernatant, add 300µL of the and put in the -20° freezer.

0h 10m 0s 900rcf,4°C

Discard most of the supernatant. Leave a bit in the bottom to ensure that there is enough for the reaction and that the pellet stays intact

Add the reaction mix to the pellet and remaining water and resuspend the pellet in the mix

A	B
Amount	Reagents
25 ul	2X TD buffer
16.5 ul	1X PBS (cold)
0.5 ul	1% digitonin
0.5 ul	10% Tween -20
2.5 ul	TN5 assembly

Reaction Mix

Put the tube into the thermomixer at 1000rpm

Take the tubes out and immediately proceed to the column clean up

Use the Zymo DNA clean & concentrator to clean the nuclei

Add 2-7 volumes of the DNA binding buffer to each volume of DNA sample

So in this case the volume is approximately 50µL , so add 300µL of DNA binding buffer

Transfer mixture to a provided Zymo-spin column in a collection tube

Centrifuge 10000x g

Discard supernatant

Add 200µL DNA wash buffer to the column

Centrifuge 10000x g

repeat the wash step

Trasnfer the column to a 1.5 low-bind eppendorf tube.

Add 21µL 2 DNA Elution buffer to the column.

Centrifuge 10000x g

Can stop here and start the next day if necessary.

Leave samples in 4°

Set up PCR;

A	B
Amount	Reagent
2.5 ul	Primer AD1
2.5 ul	Primer AD2.#
25 ul	NEBNext Master Mix
20 ul	sample

PCR

PCR program - ATAC-seq pre-amplification

A	B	C
Tempurature	Time	Cycle
72°	5 minutes	1
98°	30 seconds	-
98°	10 seconds	5
63°	30 seconds	-
72°	1 minute	-
72	5 minutes	1
4	infinate	-

ATAC-seq pre-amplification

Remove PCR tubes from the machine and put immediately onto ice.

Proceed immediately to the qPCR amplification to determine additional cycles step

qPCR amplification to determine additional cycles

prepare a mix or master mix

A	B	C
Reagent	1X	6.5X
Molecular grade water	3.76 ul	24.5 ul
Primer AD1	0.5 ul	6.5 ul
Primer AD2.#	0.5 ul	0.5 ul *
25x SYBR green (in DMSO)	0.24 ul	1.56 ul
2x NEBNext Master Mix	5 ul	32.5 ul

qPCR mix

qPCR program

A	B	C
Tempurature	Time	Cycle
98°	30 seconds	1
98°	10 seconds	20
63°	30 seconds	-
72°	1 minute	-

qPCR program

qPCR extra setup options

• 6 machine not 6

• standard

• SYBR green

• no melt curve

• turn off ROX

• Fill in sample list

Determine the required amount of cycles that each sample needs in addition

Looking at the final amplification curve, determine the max fluorescence where the graph plateaus

Determine 1/3 of that number.

For example if the max is 1400000 then 1/3 would be 433333

Check the graph for how many cycles line up with this number from the curve.

In the case above it would be 6 because of where the line was

Continue the PCR with the additional amount of cycles skipping the beginning parts of the program

of addtional cycles

A	B	C
Tempurature	Time	Cycle
98°	10 seconds	Based on calculation
63°	30 seconds	-
72°	1 minute	-
4°	Infinate	1

Additional cycles

Take the tubes out and immediately proceed to the column clean up

Use the Zymo DNA Clean & Concentrator to clean the nuclei

Add 2-7 volumes of the DNA binding buffer to each volume of DNA sample

So in this case the volume is approximately 50 ul, so add 300 ul of DNA binding buffer

Transfer mixture to a provided Zymo-spin column in a collection tube

Centrifuge 10000x g

Discard supernatant

Add 200µL DNA wash buffer to the column

Centrifuge 10000x g

Repeat the wash step

Transfer the column to a 1.5 low-bind Eppendorf tube.

Add 21 ul Sterile water buffer to the column.

Centrifuge 10000x g

Quality control

TapeStation (DS1000) and Qubit quantification