18S rRNA-Gene Metabarcoding Library Prep: Dual-PCR Method

Ensure that the laboratory is appropriately configured and that staff has appropriate training. See "Guidelines" for more information. Pay attention to the separation of pre and post-PCR spaces and equipment.

Ensure that all reagents are aliquoted in appropriate amounts, and stored according to manufacturers' recommendations. Never pipet directly from reagent stocks.

Prepare the SPRI beads' working solution, and test their efficiency following this protocol.

Serapure Preparation and Testing

Prepare primer working stocks (10μM) for both the first and second PCR steps. Here we use Nextera V2 Kit Sets A, B, C, and D. We advise preparing the indexing primers on 96-well plates according to this configuration:

Indexes_plate.xlsx

We advise adding aliquots of the extracted DNA to a 96-Well PCR plate to facilitate the setup of the PCR reaction. This metadata template will help keep track of the samples, and if indexes are configured as described above, also the identity of sample indexes.

Preparations

Reagents:

(Or equal)

• Custom-designed primers ( Balzano et al 2015 ) including: | A | B | C | | --- | --- | --- | | Balzano_565F_overhang | forward | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCAGCASCYGCGGTAATTCC | | Balzano_981R_overhang | reverse | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGACTTTCGTTCTTGATYRR |

UV for 30 minutes the following:

• 96-well PCR plates (or 8-strip tubes)
• Sharpie
• Pipette tips
• Multichannel pipettes
• Pipettes
• Sterile Nuclease-Free Water

Thaw Taq, BSA, Primers, and nuclease-free water. Keep them in a cooling microcentrifuge tube rack.

PCR reactions are carried out in triplicate 25μl reactions:

A	B
Sterile Nuclease-Free water	7.3
Forward primer (10μM)	0.6
Reverse Primer (10μM)	0.6
BSA (10mg/ml)	2
2XTaq	12.5
DNA (1-10 ng)	2
TOTAL	25

Seal the 96-well plates and transfer them to thermocyclers.

A	B	C	D
denaturation	98°C	1 minutes
denaturation	98°C	30 seconds
annealing	53°C	30 seconds
extension	72°C	45 seconds
GO TO step 2			10 times
denaturation	98°C	10 seconds
annealing	50°C	30 seconds
extension	72°C	10 seconds
GO TO step 6			19 times
final extension	72°C	2 minutes
HOLD	12°C	HOLD

Run a subset of the PCR product (5μl) on a 1.5% agarose gel to check the size of the amplicons and the success of the amplification.

Preparations

Materials

• Serapure SPRI beads. If not already prepared:
• Magnetic 96-well plate stand
• Anhydrous Ethanol to make a fresh 80% ethanol solution
• Molecular grade water

UV for 30 minutes the following:

• 96-well PCR plates (or 8-strip tubes)
• Sharpie
• Pipette tips
• Multichannel pipettes
• Pipettes
• Sterile Nuclease-Free Water

Remove the magnetic beads from the fridge (allow 30 min to reach room temperature).

Vortex the beads before use.

• Add 16 μl beads to 20 μl of PCR product to obtain a ratio of 0.8.
• Pipette up and down ten times (or until the solution is well mixed – you will see that the color changes).
• Spin tubes down to remove drops from the walls.

Incubate at room temperature without shaking for 5 min.

Then, place the plate on the magnetic stand until the supernatant has cleared (~ 3 min).

Remove the supernatant with a multichannel pipette, ensuring to not disturb the beads.

With the samples on the magnetic rack, wash the beads by adding 180 μl of freshly prepared 80% ethanol and incubate for 30s. Carefully remove the supernatant without disturbing the beads.

Repeat the washing step

Remove all residual ethanol using a pipette and air dry, leaving the samples on the magnetic stand (~ 5 min*).

 Remove the plate from the magnetic stand and add 40 μl of nuclease-free water for elution. Gently pipet up and down ten times to resuspend the beads.  Incubate the plate at room temperature for 5 min.

Place the plate back on the magnetic rack for at least 5 min or until the supernatant is cleared. 

Carefully transfer 30 μl of the clear supernatant to a new plate. Seal the plate.

Name the plate: Project, [Gene_name], PCR 1, Post-Purification Plate #, Date,  Initials.

Samples can be stored at -20°C for up to 7 days.

( IF this is the cleanup of the second PCR product )

Preparations

Reagents:

• i5 and i7 index plates (10 μM) – If not already prepared: | A | B | C | | --- | --- | --- | | Nextera V2 Index1 | forward | CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG | | Nextera V2 Index 2 | reverse | AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC |

UV for 30 minutes the following:

• 96-well PCR plates (or 8-strip tubes)  

• Sharpie 

• Pipette tips 

• Multichannel pipettes  

• Pipettes  

• Sterile Nuclease-Free Water

Thaw Taq, i5 and i7 indexes, and nuclease-free water. Keep them in the  IsoFreeze microcentrifuge tube rack.

Dilute the cleaned-up PCR (1:10) with sterile nuclease-free water.

Prepare PCR reaction in 25μl reactions:

A	B
Sterile Nuclease-Free water	5
Forward primer (10μM)	2.5
Reverse Primer (10μM)	2.5
2XTaq	12.5
DNA (1-10 ng)	2.5
TOTAL	25

Seal the 96-well plates and transfer them to thermocyclers.

A	B	C	D
denaturation	95°C	3 minutes
denaturation	95°C	30 seconds
annealing	55°C	30 seconds
extension	72°C	30 seconds
GO TO step 2			7X
final extension	72°C	5 minutes
HOLD	12°C	HOLD

Run a subset of the PCR product (5μl) on a 1.5% agarose gel to check the size of the amplicons and the success of the amplification.

Repeat the Ampure XP bead cleanup for all the indexed libraries.

Use a fluorometric quantification method that uses dsDNA dyes to measure the concentration of your libraries (Qubit or plate reader). If using Qubit, give preference to the broad range kit if you visualize a strong band in the gel: OR

Citation

Samples will have approximately similar concentrations (usually). Re-check samples that showed very high or low concentrations on Qubit/plate reader quantification. 

Calculate sample volume to have a final amount of 10-40 ng. This amount may vary depending on the overall quantification. For example, if on average the concentration of your samples is about 3 ng/μl and you have 20 μl of product,  you can calculate the volume to make up to 60 ng per sample.

Measure the final library pool concentration on Qubit using

Label tube: [Gene_name], [Project_Name], Pooled Amplicons. Date, Initials, pool concentration.

Library fragment size (BP) is determined using

Molarity of thefinal pool is assessed using

COI libraries are sequenced an a MiSeq instrument using:

with pair-end setup (2*300 bp), spiked with 10% .