nCoV-2019 Illumina Miniseq sequencing protocol (2,000bp amplicon)

Dilute the sample depending on the Ct values, this will reduce the likelihood of PCR-inhibition.

Ct range Sample Water

12-15 2µL 198µL

16-18 2µL 18µL

18 no dilution

We use the

Mix (pipetting) the following components in Eppendorf tube.

Component Volume

Nuclease-free water 4µL

GoScriptTM Reaction Buffer, Random Primer 2µL

GoScriptTM Enzyme Mix 0.4µL

Final volume 10µL

Prepare the mastermix on ice, mix by pipetting.

Component Volume

GoScriptTM Reverse Transcription Mix 10µL

RNA 3µL

Final volume 13µL

Incubate the reaction as follows:

Anneal primers 25°C for 0h 5m 0s

Extension 42°C for 1h 0m 0s

Inactivation 70°C for 0h 15m 0s

Snap cool in a prechilled metal rack or on ice 0h 1m 0s

PRIMERS for this protocol are described in protocol nCoV-2019 sequencing protocol (RAPID barcoding, 1200bp amplicon) and are the 2,000 bp option.

We selected for 2,000 bp amplicons so they could be more easily tagmented in the library preparation.

Two pooles are prepared, Pool1 with 18 primers and Pool2 with 16 primers.

POOL1. Average Tm 61.01°C

A	B	C	D	E	F	G	H	I	J	K	L
Name	Sequence	Direction	Start	End	Length	Product Size	Tm	%GC	Hairpin Tm	Pair Dimer Tm	Self Dimer Tm
SARSCoV_2000_01_LEFT	ACCAACCAACTTTCGATCTCTTGT	forward	31	54	24	2049	60.7	41.7	None	None	None
SARSCoV_2000_01_RIGHT	ACACCACCTGTAATGTAGGCCA	reverse	2058	2079	22	2049	61.4	50	39	None	5
SARSCoV_2000_03_LEFT	TCGCACAAATGTCTACTTAGCTGT	forward	3772	3795	24	1814	60.6	41.7	None	0.7	None
SARSCoV_2000_03_RIGHT	GTGTGCCCATGTACATAACAGCT	reverse	5563	5585	23	1814	61.2	47.8	42.7	0.7	8.3
SARSCoV_2000_05_LEFT	CAATCATGCAATTGTTTTTCAGCTATTTTG	forward	7299	7328	30	1825	60.4	30	33	None	7.4
SARSCoV_2000_05_RIGHT	CGTGTGTCAGGGCGTAAACTTT	reverse	9102	9123	22	1825	61.6	50	None	None	None
SARSCoV_2000_07_LEFT	GGACGTACCATATTGGGTAGTGC	forward	10886	10908	23	1834	60.8	52.2	43.8	None	None
SARSCoV_2000_07_RIGHT	TCTGTCGTAGTGCAACAGGACT	reverse	12698	12719	22	1834	61.3	50	41.4	None	14
SARSCoV_2000_09_LEFT	ACCACTTCAGAGAGCTAGGTGT	forward	14477	14498	22	1925	60.5	50	None	None	None
SARSCoV_2000_09_RIGHT	ACAACCTGGAGCATTGCAAACA	reverse	16380	16401	22	1925	61.5	45.5	None	None	11.9
SARSCoV_2000_11_LEFT	TGGCATACCTAAGGACATGACCT	forward	18168	18190	23	1814	60.9	47.8	38.3	None	11.2
SARSCoV_2000_11_RIGHT	CAGTGAGTGGTGCACAAATCGT	reverse	19960	19981	22	1814	61.6	50	38.7	None	20.4
SARSCoV_2000_13_LEFT	TCCTCAGTTTTACATTCAACTCAGGA	forward	21695	21720	26	1937	60.2	38.5	45.2	None	0.9
SARSCoV_2000_13_RIGHT	TGACTAGCTACACTACGTGCCC	reverse	23610	23631	22	1937	61.5	54.5	37	None	None
SARSCoV_2000_15_LEFT	AGGAGTCAAATTACATTACACATAAACGAA	forward	25360	25389	30	1805	60.1	30	None	None	None
SARSCoV_2000_15_RIGHT	ACTGCTACTGGAATGGTCTGTGT	reverse	27142	27164	23	1805	61.6	47.8	None	None	None
SARSCoV_2000_17_LEFT	ACTTGTCACGCCTAAACGAACA	forward	27873	27894	22	1918	60.7	45.5	36.7	None	None
SARSCoV_2000_17_RIGHT	TAGGCAGCTCTCCCTAGCATTG	reverse	29769	29790	22	1918	61.6	54.5	45.3	None	None

Pool1

POOL2. Average Tm 61.05°C

A	B	C	D	E	F	G	H	I	J	K	L
Name	Sequence	Direction	Start	End	Length	Product Size	Tm	%GC	Hairpin Tm	Pair Dimer Tm	Self Dimer Tm
SARSCoV_2000_02_LEFT	AGGCCGCTATAACAATACTAGATGGA	forward	1956	1981	26	1923	61.3	42.3	None	None	None
SARSCoV_2000_02_RIGHT	CAGCGATCTTTTGTTCAACTTGCT	reverse	3855	3878	24	1923	60.8	41.7	None	None	None
SARSCoV_2000_04_LEFT	TCAACATGCCAATTTAGATTCTTGCA	forward	5473	5498	26	1929	60.3	34.6	None	8.1	None
SARSCoV_2000_04_RIGHT	GCTGAAATCGGGGCCATTTGTA	reverse	7380	7401	22	1929	61.5	50	None	8.1	4.4
SARSCoV_2000_06_LEFT	GCTGCTGAATGTACAATTTTTAAAGATGC	forward	9011	9039	29	2003	61.1	34.5	None	None	None
SARSCoV_2000_06_RIGHT	AACCAGTGGTGTGTACCCTTGA	reverse	10992	11013	22	2003	61.5	50	47	None	17.6
SARSCoV_2000_08_LEFT	TCACCTAATTTAGCATGGCCTCTT	forward	12620	12643	24	1956	60.1	41.7	None	None	3.3
SARSCoV_2000_08_RIGHT	CAGGGTCAGCAGCATACACAAG	reverse	14554	14575	22	1956	61.5	54.5	None	None	None
SARSCoV_2000_10_LEFT	TGCATACGTAGACCATTCTTATGTTGT	forward	16291	16317	27	1985	60.8	37	32.8	None	0.1
SARSCoV_2000_10_RIGHT	GCTTCTTCGCGGGTGATAAACA	reverse	18254	18275	22	1985	61.5	50	None	None	6.1
SARSCoV_2000_12_LEFT	GGACTACAAAAGAGATGCTCCAGC	forward	19878	19901	24	1920	61.5	50	42.5	11.2	None
SARSCoV_2000_12_RIGHT	ACCTCTTAGTACCATTGGTCCCA	reverse	21775	21797	23	1920	60.5	47.8	37.1	11.2	12.7
SARSCoV_2000_14_LEFT	GCTGAACATGTCAACAACTCATATGA	forward	23519	23544	26	1973	60.1	38.5	35.2	None	5.1
SARSCoV_2000_14_RIGHT	TGCAGTAGCGCGAACAAAATCT	reverse	25470	25491	22	1973	61.4	45.5	46.2	None	12.1
SARSCoV_2000_16_LEFT	TCTTATTACAAATTGGGAGCTTCGCA	forward	27051	27076	26	1995	61.3	38.5	37.6	None	None
SARSCoV_2000_16_RIGHT	GCTTCTTAGAAGCCTCAGCAGC	reverse	29024	29045	22	1995	61.6	54.5	43.6	None	30.4

Pool2.

PRIMER STOCKS (100micromolar (µM) )

If you have ordered each primer independently and need to generate primer pool stocks: add 5µL of each primer from Pool 1 to a 1.5mL Eppendorf labeled “Pool 1 (100µM)” and each primer from Pool 2 to a 1.5mL Eppendorf labelled “Pool 2 (100µM)”. These are your 100micromolar (µM) stocks of each primer pool.

WORKING PRIMERS (10micromolar (µM) )

Dilute the primer stocks 1:10 in molecular grade water, to generate 10µM primer working stocks . It is recommend that multiple aliquots of each primer pool are made to in case of degradation or contamination.

POOLING OF PRIMERS

Label two 1.5mL Eppendorf tubes, one as POOL1 and the another as POOL2 .

Add 10µL of each of the primers of set 1 to the Eppendorf tube labelled POOL1, final concentration will be 10micromolar (µM)

Add 10µL of each of the primers of set 2 to the Eppendorf tube labelled POOL2, final concentration will be 10micromolar (µM)

In the PCR hood set up the multiplex mastermix reaction as follows in 2 0.2mL PCR tubes. We use the

Component Pool 1 Pool 2 Final Concentration

5X Kapa HotStart Buffer 2.5µL 2.5µL 1X

25 mM MgCl2 0.75µL 0.75µL 1.5millimolar (mM)

10 mM dNTPs 0.25µL 0.25µL 0.2millimolar (mM)

Primer Pool 1 or 2 (10µM ea) 0.6µL 0.6µL 0.5micromolar (µM)

Kapa Taq HotStart Polymerase 0.1µL 0.1µL 0.5U

Nuclease-free water 5.8µL 5.8µL

Final mastermix volume 10.0µL 10.0µL

Note

A PCR mastermix for each pool should be made up in the mastermix cabinet and aliquoted into PCR strip tubes. Tubes should be wiped down when entering and leaving the mastermix cabinet.

In the extraction and sample addition cabinet add 2.5µL cDNA to each tube and mix well by pipetting.

The final volume will be 12.5µL

Pulse centrifuge the tubes to collect the contents at the bottom of the tube.

Set-up the following program on the thermal cycler:

Step Temperature Time Cycles

Heat Activation 98°C 0h 0m 30s 1

Denaturation 95°C 0h 0m 15s 25-35

Annealing and Extension 60°C 0h 5m 0s 25-35

Hold 4°C Indefinite 1

Amplicon quantification to make an equimolar mixture.

Put 1µL of each pool in a Nanodrop or similar spectometer and quantify the DNA concentration.

Label a 1.5mLEppendorf tube for each sample and make a equimolar mix with the two pools.

Calculate to achieve a final concentration of 50

Quantify DNA using a Qubit or other method.

Quantification using Nanodrop is not recommended for a good estimation of the final pool.

Protocol

DNA quantification using the Qubit fluorometer

Label a 0.2mL PCR tube for each sample.

Adjust the amount of DNA in the tube to be 100ng total per sample in 7.5µL molecular grade water.

We have reduced the amount of reagents used per reaction.

Label a 1.5mLEppendorf tube for each sample and add in this order:

Component Volume

1. Tagment DNA buffer (TD) 3.75µL
2. cDNA 2ng/µl 3µL Pipette 10 times to mix

Add Amplicon Tagment Mix 0.5µL and pipette 10 times to mix

Centrifuge at 280x g,20°C

Incubate in thermal cycler

55°C for 0h 10m 0s

10°C

Add 2µL of Neutralize Tagment Buffer (NT).

Pipette 10 times to mix

Centrifuge at 280x g,20°C

Incubate at Room temperature for 0h 5m 0s °C

Preserve the samples at 4-8°C until use.

La siguiente reacción requiere de la enzima polimerasa 2x Ampigene HS Taq Mix Catalog # ENZ-NUC101-0200 y de los sets de Nextera XT. Cada set contiene 96 combinaciones de TAGs con esto podemos alcanzar 384 muestras usando los Nextera XT Index Kit v2 (Sets A,B,C y D) Catalog # 20027213;20027214;20027215;20027216.

A cada tubo de reaccion agregar:

Component Volume

Nuclease-free water 10µL

2x Ampigene HS Taq Mix. 10µL

Nextera XT index i5 1µL

Nextera XT index i7 1µL

ADN Tagmentado 3µL

Final volume 25µL

Centrifuge at 280x g,20°C

Set-up the following program on the thermal cycler:

Cover 100 °C

Step Temperature Time Cycles

Heat Activation 72°C 0h 3m 0s 1

Denaturation 95°C 0h 0m 30s 1

                                              `95°C`        `0h 0m 10s`     

Annealing and Extension 55°C 0h 0m 30s 14

                                              `72°C`        `0h 0m 30s`  

Hold 4°C Indefinite 1

Al volumen que se tiene en el tubo agregar 0.8X de perlas magnéticas Ampure XP.

Mezclar y spin-down.

Llevar al magneto hasta formar el pellet y desechar el sobrenadante.

Agregar 150 uL de etanol 80% en posición contraria al pellet. Esperar 30 segundos.

Desechar el etanol.

Retirar el exceso de etanol y secar las perlas por 5 min.

Resuspender las perlas en 26 uL de Agua libre de nucleasas.

Mix y spin down. Incubar por 5 min a TA.

Llevar al magneto hasta formar el pellet y transferir 25 uL del sobrenadante a un nuevo tubo previamente etiquetado.

Cuantificar 2 uL por Qubit HS y analizar los tamaños mediante electroforesis en gel de agarosa al 1.0%.

A partir de la concentración en ng/uL determinada por Qubit y obtenido el tamaño aproximado del fragmento, llevar cada una de las librerias a una concetracion de 4 nM.

Transferir 5 uL de cada librerías a 4 nM aun tubo previamente etiquetado para obtener el pool final.

Seguir el protocolo Library Denaturing and miniseq Sample Loading del kit