Preparing Combined Indexed Primer Plates (IDT Ultramers) for the Illumina MiSeq - IDT UDIs

Use our Excel template (Illumina-IDT-UDI-8bp-customfusionprimers-template.xlsx) to copy existing 16S/18S/ITS primers or to design your own custom gene primers with the proper Illumina indices and Nextera adapter orientations. We order IDT “Ultramers” for such long primers (~80-90 nt) as their coupling efficiency is one of the highest available (critical for obtaining high proportions of full-length oligos in the mix you obtain). Order the fusion primers at 4nanomolar (nM) scale in deep-well plates (DWP); there will be 4 x 96-well plates, with one unique Forward primer + one unique Reverse primer combined in each well , arranged as follows:

F1R1 Plate (P1) = UDIs 1-96 (ie: i5_1+i7_1 in well A1, i5_2+i7_2 in well A2, etc.)

F1R2 Plate (P2) = UDIs 97-192

F2R1 Plate (P3) = UDIs 193-288

F2R2 Plate (P4) = UDIs 289-384

Once arrived, do a short spin of the plate in case lyophilized material was dislodged, then add 400µL of PCR-grade water to each well of each plate containing the primers in order to reconstitute them at a concentration of 10micromolar (µM) (1/10th the typical 100 µM working stock concentration for primers). Mix well by pipetting up and down at least 3 times and seal the plate with Bio-Rad film. Alternatively, the plate is sealed with Bio-Rad film and mixed well by vortexing it on a benchtop vortex for 0h 0m 30s and then doing a short spin at approx. 500rpm. We have found that these primers usually need a significant incubation time for the lyophilized pellets to re-suspend well – we typically leave them overnight at 4°C before continuing.

Prepare the combined 1micromolar (µM) working stock F1R1 Primer Plate by pipetting 228µL of PCR-grade water into each well of an empty 96-well DWP from a sterile reservoir. Working by column and changing tips each time, transfer 12µL of reconstituted F1R1 stock primer into each well of each column, mixing well by pipetting. Once complete, the resulting plate will have enough primer for 30 PCR plates (8 µL combined F+R per rxn × 30 = 240 µL). Seal the plate with PCR film and store at -20°C.

Prepare the combined 1micromolar (µM) working stock F1R2 Primer Plate by repeating Step 3, but using the above reconstituted F1R2 stock deep-well primer plate.

Prepare the combined 1micromolar (µM) working stock F2R1 Primer Plate by repeating Step 3, but using the above reconstituted F2R1 stock deep-well primer plate.

Prepare the combined 1micromolar (µM) working stock F2R2 Primer Plate by repeating Step 3, but using the above reconstituted F2R2 stock deep-well primer plate.

Once all aliquoting is complete, seal the DWPs with PCR film and archive at -20°C until new aliquots are required (minimized freeze-thaw cycles).

Optional: For the generation of 18S V4 amplicons from microbiome samples containing substantial non-target host DNA (ex: human, mouse, etc.), order (ex: from PNA Bio) a custom PNA mammalian blocking primer (elongation arrest in the V4 region) with the sequence: 5’- TCTTAATCATGGCCTCAGTT -3’ (courtesy of Laura Parfrey and Matt Lemay, UBC). Once arrived, prepare an archival stock of 100micromolar (µM) and a working stock of 10micromolar (µM) using PCR-grade water.